ID: 968257653_968257655

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 968257653 968257655
Species Human (GRCh38) Human (GRCh38)
Location 3:197292002-197292024 3:197292036-197292058
Sequence CCTGTGTGCTGCTGGTGAGACTG AATCACTATGGAAAACATTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 40, 4: 291} {0: 2, 1: 40, 2: 562, 3: 2521, 4: 5881}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!