ID: 968273626_968273631

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 968273626 968273631
Species Human (GRCh38) Human (GRCh38)
Location 3:197423590-197423612 3:197423617-197423639
Sequence CCAGAACTAGGAAAGAGAGGCAG GCTCAGGACCCGAGGAGGGATGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 3, 3: 25, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!