ID: 968286196_968286204

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 968286196 968286204
Species Human (GRCh38) Human (GRCh38)
Location 3:197510249-197510271 3:197510273-197510295
Sequence CCTCAGGCTCGGGCGGCAGCGCG GAGTCTGGGGCGCTGGAGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 153} {0: 1, 1: 2, 2: 3, 3: 54, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!