|
Left Crispr |
Right Crispr |
| Crispr ID |
968315102 |
968315110 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:197717348-197717370
|
3:197717398-197717420
|
| Sequence |
CCAGGAGAATGCTGTGAACCCGG |
CGCACCACCGCACTCCAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 21, 2: 161, 3: 249, 4: 621} |
{0: 405, 1: 22432, 2: 109531, 3: 193248, 4: 219695} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|