ID: 968322927_968322936

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 968322927 968322936
Species Human (GRCh38) Human (GRCh38)
Location 3:197787397-197787419 3:197787442-197787464
Sequence CCCGGCCTAGAAGTGGAGTCTTA TCTACTGAGTAGAAGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 260} {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!