ID: 968372736_968372744

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 968372736 968372744
Species Human (GRCh38) Human (GRCh38)
Location 4:10921-10943 4:10968-10990
Sequence CCGCGGCGCAGGCGCAGAGACGG GACGGACGCCGCCGCGGCGCAGG
Strand - +
Off-target summary {0: 9, 1: 2, 2: 4, 3: 20, 4: 110} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!