ID: 968373527_968373530

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 968373527 968373530
Species Human (GRCh38) Human (GRCh38)
Location 4:17590-17612 4:17615-17637
Sequence CCTGTCTCAAAAAAAATGTTTTT AGGAAAACTACAGCCTTTGTGGG
Strand - +
Off-target summary {0: 4, 1: 130, 2: 417, 3: 1263, 4: 4321} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!