|
Left Crispr |
Right Crispr |
| Crispr ID |
968377502 |
968377513 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:55131-55153
|
4:55176-55198
|
| Sequence |
CCCGCCTCGGCCTGCCAAAGTGC |
CGCGCCCGGCCTCCCACCCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 313, 1: 87860, 2: 225410, 3: 236406, 4: 156188} |
{0: 2, 1: 0, 2: 0, 3: 18, 4: 239} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|