ID: 968378940_968378949

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 968378940 968378949
Species Human (GRCh38) Human (GRCh38)
Location 4:71959-71981 4:72002-72024
Sequence CCTTGGGAGGGTGGTCATTGAGT GGTGGGAGGATCTATATCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109} {0: 1, 1: 0, 2: 4, 3: 17, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!