ID: 968397195_968397196

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 968397195 968397196
Species Human (GRCh38) Human (GRCh38)
Location 4:251316-251338 4:251357-251379
Sequence CCTAATGTGACACACACACACAC ATGTATACACACATTTGTCGTGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 74, 3: 522, 4: 3065} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!