ID: 968410706_968410719

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 968410706 968410719
Species Human (GRCh38) Human (GRCh38)
Location 4:387267-387289 4:387300-387322
Sequence CCTGCTGGGCCCTGTCCTGTTCC CTCCGAGGGAGAGAGGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 41, 4: 395} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!