ID: 968434160_968434167

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 968434160 968434167
Species Human (GRCh38) Human (GRCh38)
Location 4:576338-576360 4:576357-576379
Sequence CCAGGAGGCTCGTTCCCCCCCAA CCAACCCCCCACCCCGCCCGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 62, 4: 578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!