ID: 968443101_968443108

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968443101 968443108
Species Human (GRCh38) Human (GRCh38)
Location 4:634367-634389 4:634385-634407
Sequence CCGGAGGGCGGCAGGTGCGTGAG GTGAGGTGCCAGGCAGGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 207} {0: 1, 1: 0, 2: 5, 3: 64, 4: 558}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!