ID: 968443101_968443116

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 968443101 968443116
Species Human (GRCh38) Human (GRCh38)
Location 4:634367-634389 4:634415-634437
Sequence CCGGAGGGCGGCAGGTGCGTGAG TGAGGCCTGTCCAAGTCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 207} {0: 1, 1: 0, 2: 0, 3: 11, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!