ID: 968453437_968453451

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 968453437 968453451
Species Human (GRCh38) Human (GRCh38)
Location 4:685854-685876 4:685901-685923
Sequence CCCTTCTTGACCAGCACAGGGGA CAGAGGGTTCGCTGGGTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 152} {0: 1, 1: 0, 2: 5, 3: 24, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!