ID: 968460736_968460739

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968460736 968460739
Species Human (GRCh38) Human (GRCh38)
Location 4:723595-723617 4:723613-723635
Sequence CCTTCAGTCTGGTTGTGTGGGGC GGGGCAGGGTCCTCACCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 114} {0: 1, 1: 1, 2: 3, 3: 50, 4: 424}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!