ID: 968466713_968466716

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 968466713 968466716
Species Human (GRCh38) Human (GRCh38)
Location 4:755312-755334 4:755337-755359
Sequence CCAGTCTCCTGTGTGTGGGGTGT AGCGACTCATCGCACGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 33, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!