ID: 968476852_968476859

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 968476852 968476859
Species Human (GRCh38) Human (GRCh38)
Location 4:814686-814708 4:814699-814721
Sequence CCAGGTTTTCCCCAGGAGTCCGG AGGAGTCCGGGAGGAACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 24, 3: 15, 4: 154} {0: 1, 1: 0, 2: 1, 3: 24, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!