ID: 968489305_968489308

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 968489305 968489308
Species Human (GRCh38) Human (GRCh38)
Location 4:881518-881540 4:881563-881585
Sequence CCTAAACACGCTGTGACTGTACT CTCCACACGGCACCTGTGTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!