ID: 968495013_968495018

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 968495013 968495018
Species Human (GRCh38) Human (GRCh38)
Location 4:910576-910598 4:910603-910625
Sequence CCTGCGCTAGCCGGCCTGCGGGA CTCCTCCTGGCTGCTGAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 42, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!