ID: 968496706_968496712

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 968496706 968496712
Species Human (GRCh38) Human (GRCh38)
Location 4:922062-922084 4:922086-922108
Sequence CCCAAAATGCATCTGCGGAAGCC CAGATGACCCTATGCGGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 80, 4: 590} {0: 1, 1: 0, 2: 0, 3: 5, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!