ID: 968509291_968509299

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 968509291 968509299
Species Human (GRCh38) Human (GRCh38)
Location 4:988299-988321 4:988319-988341
Sequence CCTGGGCCCTGACGCTGGTGCAG CAGGTGGCCACCCTGTGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 293} {0: 1, 1: 0, 2: 6, 3: 22, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!