ID: 968526941_968526944

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 968526941 968526944
Species Human (GRCh38) Human (GRCh38)
Location 4:1064205-1064227 4:1064223-1064245
Sequence CCATATATATGTACATAAATACA ATACATATGACAAAGCAGGTGGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 31, 3: 360, 4: 3231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!