ID: 968528732_968528738

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 968528732 968528738
Species Human (GRCh38) Human (GRCh38)
Location 4:1078671-1078693 4:1078693-1078715
Sequence CCCTTTCTCCTTGACACCAACAG GAGACTGACAGGGACCAGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 344} {0: 1, 1: 0, 2: 4, 3: 25, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!