ID: 968545134_968545140

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 968545134 968545140
Species Human (GRCh38) Human (GRCh38)
Location 4:1194430-1194452 4:1194446-1194468
Sequence CCGGATGGAGCGGCTGGCGTGCC GCGTGCCCTGCAGGGGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 81, 4: 1533} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!