ID: 968545142_968545147

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 968545142 968545147
Species Human (GRCh38) Human (GRCh38)
Location 4:1194452-1194474 4:1194465-1194487
Sequence CCTGCAGGGGGAGTGGGAAGAAA TGGGAAGAAACGGGGAAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 383} {0: 1, 1: 0, 2: 1, 3: 30, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!