ID: 968547890_968547905

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 968547890 968547905
Species Human (GRCh38) Human (GRCh38)
Location 4:1207938-1207960 4:1207979-1208001
Sequence CCCTCCTGGTGCTTGATGCCAAG GAGAGGCCCAGGGCCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149} {0: 1, 1: 0, 2: 5, 3: 68, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!