ID: 968550082_968550095

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 968550082 968550095
Species Human (GRCh38) Human (GRCh38)
Location 4:1217590-1217612 4:1217640-1217662
Sequence CCCCGGAAGTCGGGCTGCCGGTG GCGCCGGCCACGCCTGACACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54} {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!