ID: 968551595_968551608

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 968551595 968551608
Species Human (GRCh38) Human (GRCh38)
Location 4:1226277-1226299 4:1226326-1226348
Sequence CCCTGCACGGCACTTCCCACCCC GACTGGCCATCCGTCTCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 311} {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!