ID: 968551600_968551614

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 968551600 968551614
Species Human (GRCh38) Human (GRCh38)
Location 4:1226296-1226318 4:1226336-1226358
Sequence CCCCATCCGGATGATTGCATTCC CCGTCTCCCTGGGGAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 187} {0: 1, 1: 0, 2: 3, 3: 40, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!