ID: 968563902_968563909

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 968563902 968563909
Species Human (GRCh38) Human (GRCh38)
Location 4:1299308-1299330 4:1299348-1299370
Sequence CCTTGATGCCTCTGTTGTCACAG TGCCCCTCCACCCTGGCGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 195} {0: 1, 1: 0, 2: 1, 3: 22, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!