ID: 968568455_968568469

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 968568455 968568469
Species Human (GRCh38) Human (GRCh38)
Location 4:1327172-1327194 4:1327219-1327241
Sequence CCCAGTCTACATTCGGGATAGTT TAGAGGAAGCAGTGGCCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48} {0: 1, 1: 0, 2: 3, 3: 26, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!