ID: 968574929_968574933

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 968574929 968574933
Species Human (GRCh38) Human (GRCh38)
Location 4:1361207-1361229 4:1361224-1361246
Sequence CCAGGCCTGTGGTGCTGTGGTCC TGGTCCTGGCCCCTGCAGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 23, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!