ID: 968577532_968577550

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 968577532 968577550
Species Human (GRCh38) Human (GRCh38)
Location 4:1374879-1374901 4:1374931-1374953
Sequence CCTTGAGGACCATGTGAGCACCC CTCAGGCTTGGGTGCTGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 63, 4: 733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!