ID: 968580057_968580065

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 968580057 968580065
Species Human (GRCh38) Human (GRCh38)
Location 4:1385589-1385611 4:1385629-1385651
Sequence CCAAGGTGGGGCTGGGGCCACCT CCGCCGCAGACTCCGCTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 408} {0: 1, 1: 0, 2: 1, 3: 20, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!