ID: 968607940_968607947

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 968607940 968607947
Species Human (GRCh38) Human (GRCh38)
Location 4:1544396-1544418 4:1544436-1544458
Sequence CCAGCCCCCAGCACCTCAGAATG GAGTCTTTACAGAGAAAATCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 32, 3: 189, 4: 663} {0: 2, 1: 2, 2: 1, 3: 28, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!