ID: 968607940_968607948

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 968607940 968607948
Species Human (GRCh38) Human (GRCh38)
Location 4:1544396-1544418 4:1544442-1544464
Sequence CCAGCCCCCAGCACCTCAGAATG TTACAGAGAAAATCAGGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 32, 3: 189, 4: 663} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!