ID: 968631765_968631773

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 968631765 968631773
Species Human (GRCh38) Human (GRCh38)
Location 4:1655567-1655589 4:1655596-1655618
Sequence CCCAGGCCTGCGCCTGGGCGCGG TGGCTGCCACTGAAGACCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 247} {0: 1, 1: 0, 2: 0, 3: 22, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!