ID: 968638916_968638926

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 968638916 968638926
Species Human (GRCh38) Human (GRCh38)
Location 4:1700124-1700146 4:1700171-1700193
Sequence CCAGGTCTGAGGAAGCTCCACCC ATGCAATCCAGAAGCTCCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207} {0: 1, 1: 1, 2: 0, 3: 5, 4: 70}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!