|
Left Crispr |
Right Crispr |
| Crispr ID |
968639588 |
968639593 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:1706112-1706134
|
4:1706158-1706180
|
| Sequence |
CCATCTCTAATAAAAATACAAAA |
ACCAGTAGGCCCCAGCTACTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2146, 1: 205396, 2: 140581, 3: 64923, 4: 140795} |
{0: 1, 1: 0, 2: 65, 3: 274, 4: 750} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|