ID: 968640588_968640597

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 968640588 968640597
Species Human (GRCh38) Human (GRCh38)
Location 4:1712553-1712575 4:1712574-1712596
Sequence CCTGAGGAAAAGGTTGCCCCCAC ACCCGCGGGATTGAGGCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 115} {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!