ID: 968661890_968661899

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 968661890 968661899
Species Human (GRCh38) Human (GRCh38)
Location 4:1802086-1802108 4:1802107-1802129
Sequence CCCCTTGGCTGCGGGTTGCGTGA GAGGATTTGGGTCTAGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 52} {0: 1, 1: 0, 2: 0, 3: 22, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!