|
Left Crispr |
Right Crispr |
| Crispr ID |
968669355 |
968669362 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:1840541-1840563
|
4:1840572-1840594
|
| Sequence |
CCTGTAGTGCCAGCTACTCGGGA |
CAGGAGAATGGTGTGGACCCCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 270, 1: 57609, 2: 183624, 3: 273771, 4: 189942} |
{0: 49, 1: 8647, 2: 45634, 3: 44912, 4: 109058} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|