ID: 968669358_968669366

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 968669358 968669366
Species Human (GRCh38) Human (GRCh38)
Location 4:1840550-1840572 4:1840576-1840598
Sequence CCAGCTACTCGGGAGGCTGAGGC AGAATGGTGTGGACCCCGGGGGG
Strand - +
Off-target summary {0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272} {0: 1, 1: 38, 2: 331, 3: 788, 4: 918}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!