|
Left Crispr |
Right Crispr |
| Crispr ID |
968669358 |
968669366 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:1840550-1840572
|
4:1840576-1840598
|
| Sequence |
CCAGCTACTCGGGAGGCTGAGGC |
AGAATGGTGTGGACCCCGGGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272} |
{0: 1, 1: 38, 2: 331, 3: 788, 4: 918} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|