ID: 968671901_968671905

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 968671901 968671905
Species Human (GRCh38) Human (GRCh38)
Location 4:1856411-1856433 4:1856431-1856453
Sequence CCGGGGCTCGCAGCGTGGCGGCC GCCGCAGGAGCTGAGGGAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 199} {0: 1, 1: 0, 2: 4, 3: 40, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!