ID: 968673427_968673438

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 968673427 968673438
Species Human (GRCh38) Human (GRCh38)
Location 4:1864332-1864354 4:1864385-1864407
Sequence CCTGGGGCCTGGGAGGCGGGGCA CCTCTTTATCTGGCCTGGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!