ID: 968673428_968673433

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 968673428 968673433
Species Human (GRCh38) Human (GRCh38)
Location 4:1864339-1864361 4:1864375-1864397
Sequence CCTGGGAGGCGGGGCAGCTTGAG ACTTGGAAGCCCTCTTTATCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!