ID: 968674584_968674599

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 968674584 968674599
Species Human (GRCh38) Human (GRCh38)
Location 4:1870918-1870940 4:1870969-1870991
Sequence CCGCGCCCCTCTCACGGGACAGG GCGCCCAACGCCAGCCTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!