ID: 968674586_968674593

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 968674586 968674593
Species Human (GRCh38) Human (GRCh38)
Location 4:1870923-1870945 4:1870938-1870960
Sequence CCCCTCTCACGGGACAGGAGCTT AGGAGCTTGGGGACCCGCGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!