ID: 968681660_968681668

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 968681660 968681668
Species Human (GRCh38) Human (GRCh38)
Location 4:1925142-1925164 4:1925191-1925213
Sequence CCCTGCTTCCATCTGTAACCTAG CGGGAGTGCTGGTGCACACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!